A comprehensive compendium of human long non-coding RNAs

UAUUUUUAUUUUUUAAAAUCUGAUUUGGUGUUCCAU UGUGAGUGUGAGAGCGAGAACAGCGCUGGCUGGGGA GCAGAUCUGCAGAAUUGAAAUGACCUGGCACUUGUC ACAAAAGACCCAAAGUGCAUUGCUGUGGAAAUCAUAG UGUGAGUGUGAGAGCGAGAACAGCGCUGGCUGGGGAC UGUGAGUGUGAGAGCGAGAACAGCGCUGGCUGGGGA GCAGAUCUGCAGAAUUGAAAUGACCUGGCACUUGUC ACAAAAGACCCAAAGUGCAUUGCUGUGGAAAUCAUAG CAAAAGACCCAAAGUGCAUUGCUGUGGAAAUCAUAGAUU CAUUGCUGUGGAAAUCAUAGAUCAAAAGACCCAAAGUG

Data

LNCipedia is a public database for long non-coding RNA (lncRNA) sequence and annotation. The current release contains 127,802 transcripts and 56,946 genes.

Literature

Currently, LNCipedia offers 2,482 manually curated lncRNA articles.

Recently added literature

Tools

LNCipidia comes with some helpful tools:

Submit your data!

The lncRNA research community is encouraged to submit data to LNCipedia.

Submit a paper (reference) or a new lncRNA to LNCipedia here

Submit a lncRNA Submit a paper

LNCipedia database

Full set High-confidence set
Transcripts 127,802 107,039
Genes 56,946 49,372

Citing

If you use LNCipedia, please cite the following paper:

An update on LNCipedia: a database for annotated human lncRNA sequences
Pieter-Jan Volders; Kenneth Verheggen; Gerben Menschaert; Klaas Vandepoele; Lennart Martens; Jo Vandesompele and Pieter Mestdagh; Nucleic Acids Research 2015
doi:10.1093/nar/gku1060 | PubMed | Google Scholar citations

Other LNCipedia papers

LNCipedia: a database for annotated human lncRNA transcript sequences and structures
Pieter-Jan Volders; Kenny Helsens; Xiaowei Wang; Bjorn Menten; Lennart Martens; Kris Gevaert; Jo Vandesompele; Pieter Mestdagh; Nucleic Acids Research 2013
doi:10.1093/nar/gks915 | PubMed | Google Scholar citations

Twitter

Recently added literature

LINC00880: Wu (2018)
LncRNA LINC00880 promotes cell proliferation, migration, and invasion while inhibiting apoptosis by targeting CACNG5 through the MAPK signaling pathway in spinal cord ependymoma.
(J. Cell. Physiol.)

LINC01672: Li (2018)
Novel long noncoding RNA NMR promotes tumor progression via NSUN2 and BPTF in esophageal squamous cell carcinoma.
(Cancer Lett.)

LINC00174: Shen (2018)
STAT1-mediated upregulation of lncRNA LINC00174 functions a ceRNA for miR-1910-3p to facilitate colorectal carcinoma progression through regulation of TAZ.
(Gene)

PAX8-AS1: Yu (2018)
Baicalein inhibits breast cancer growth via activating a novel isoform of the long noncoding RNA PAX8-AS1-N.
(J. Cell. Biochem.)

LINC01538: Samir (2018)
Competing endogenous RNA network crosstalk reveals novel molecular markers in colorectal cancer.
(J. Cell. Biochem.)

DICER1-AS1: Gu (2018)
LncRNA DICER1-AS1 promotes the proliferation, invasion and autophagy of osteosarcoma cells via miR-30b/ATG5.
(Biomed. Pharmacother.)

UGDH-AS1: Qu (2018)
Comprehensive evaluation of differential lncRNA and gene expression in patients with intervertebral disc degeneration.
(Mol Med Rep)

LRRC75A-AS1: Wang (2018)
A three‑lncRNA signature for prognosis prediction of acute myeloid leukemia in patients.
(Mol Med Rep)

ADPGK-AS1: Song (2018)
LncRNA ADPGK-AS1 promotes pancreatic cancer progression through activating ZEB1-mediated epithelial-mesenchymal transition.
(Cancer Biol. Ther.)

LINC00665: Jia (2018)
Exploring the molecular pathogenesis and biomarkers of high risk oral premalignant lesions on the basis of long noncoding RNA expression profiling by serial analysis of gene expression.
(Eur. J. Cancer Prev.)